Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-361 precursor URS000064F901_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR361: MIR361 is a microRNA that is encoded on the × chromosome and gives rise to two mature miRNA species, miRNA-361-3p and miRNA-361-5p [PMC3498195]. Previous studies have shown that MIR361 is involved in the regulation of gene expression [PMC3526356]. It has been found that MIR361 can bind to the 3'-UTR of AID and repress its expression [PMC3526356]. In Burkitt lymphoma cell lines, the responsiveness of several candidates to miR-155 and/or MIR361 was tested [PMC3526356]. SMAD4 has been identified as a negative regulator of MIR361 transcription, and its overexpression or knockdown affects the expression of MIR361 [PMC7563248]. The transcriptional regulation of MIR361 by SMAD4 has been shown to adjust VEGFA expression [PMC7563248]. In addition, MIR361 has been found to be differentially expressed in different stages of pregnancy and in women with gestational diabetes mellitus (GDM) [PMC9700700] [PMC8369952] [PMC9700700]. It has also been implicated as a tumor suppressor in endometrial cancers when downregulated, while its silencing is associated with hepatocellular carcinoma (HCC), gastric cancer (GC), and colorectal cancer (CRC) [PMC8369952] [PMC5496572] The level of MIR361 has been found to be associated with the level of miR-146a in certain conditions such as heart failure (HF) and major adverse cardiovascular events (MACE) [ PMC9433550] Overall, these studies highlight the importance of MIR361 in various biological processes such as gene regulation, pregnancy, diabetes mellitus, and cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAGCUUAUCAGAAUCUCCAGGGGUACUUUAUAAUUUCAAAAAGUCCCCCAGGUGUGAUUCUGAUUUGCUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

Publications