Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 114-10 (SNORD114-10) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 114-10 (SNORD114-10) URS000064F2D2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD114-10: SNORD114-10 is a small nucleolar RNA (snoRNA) that is downregulated in metastatic omentum tissues in ovarian cancer (OC) [PMC5769367]. It is part of the SNORD114 cluster, which includes SNORD114-2 and SNORD114-11 [PMC5769367]. The expression of SNORD114-10 in OC samples is not correlated with age, FIGO division, pathological classification, or the presence of omental metastases [PMC5769367]. The downregulation of SNORD114-10 in metastatic omentum suggests that it may suppress the migration of ovarian tumor cells to secondary sites [PMC5769367]. This snoRNA may serve as a potential biomarker for OC metastasis [PMC6629867]. SNORD114-10 belongs to the family of small nucleolar RNAs and is specifically expressed in the brain [PMC8458545]. It has been implicated in neurodevelopmental disorders such as Prader-Willi and Angelman syndromes [PMC8458545]. In addition to OC, SNORD114-10 has also been found to be downregulated in metastatic ovarian cancer compared to primary tumors [PMC8677010]. Overall, the expression levels of SNORD114-10 are altered in various contexts and may play a role in tumor migration and neurodevelopmental disorders. Further studies are needed to understand its exact mechanisms and potential therapeutic implications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGAUCAAUGAUGACUACUGUUAGUGUAUGAGUUACACAUGAUGAAUACAUGUCUGAAACUCUGAGGUCCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications