Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-589 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-589 precursor URS000064C5B0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR589: MIR589 is a miRNA gene located in the chromosomal region 7p22, which is prone to gaps and breaks in various cancers [PMC3634031]. In a study comparing different populations, it was found that MIR589 was the only differentially methylated and expressed miRNA in individuals of European ancestry [PMC8453167]. Several other miRNAs, including MIR589, have been identified as overexpressed in breast cancer and have potential applications in diagnosis, prognosis, and therapeutic studies [PMC4508501]. In an experiment investigating the effect of TGFβ1 on MIR589 expression, it was observed that TGFβ1 treatment decreased the expression of MIR589 [PMC3479401]. The decreased expression of MIR589 was also observed in human peritoneal mesothelial cells (HPMCs) isolated from peritoneal dialysis patients and HMrSV5 cells treated with TGFβ1 [PMC3479401]. Additionally, a study on IFN-γ stimulation identified MIR589 as one of the top 10 upregulated miRNAs [PMC8010072]. Overall, these findings highlight the potential role of MIR589 in cancer development and progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCAGCCUGUGCCCAGCAGCCCCUGAGAACCACGUCUGCUCUGAGCUGGGUACUGCCUGUUCAGAACAAAUGCCGGUUCCCAGACGCUGCCAGCUGGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications