Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) snoRNA (ENSG00000221498.1) secondary structure diagram

Homo sapiens (human) snoRNA (ENSG00000221498.1) URS000064B925_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA77: SNORA77 is a small nucleolar RNA (snoRNA) that is encoded on chromosome 22q11.2. It is a member of the H/ACA box snoRNA family and is also known as SNORA77 in the snoRNABase database [PMC3072320]. SNORA77 has been found to have tissue-specific effects in cancer and has been associated with different survival rates depending on the cancer type [PMC9803687]. It plays a role in the post-transcriptional modification of ribosomal RNAs (rRNAs) and is involved in improving the folding and stabilization of rRNAs [PMC6123486] [PMC7016268]. In non-small-cell lung carcinoma, higher levels of SNORA77 have been correlated with poorer overall survival [PMC9803687]. In kidney clear cell carcinoma, high levels of SNORA77 are associated with poor survival, while in kidney papillary carcinoma and liver hepatocellular carcinoma, high levels are associated with better survival [PMC6294694]. SNORA77 has also been identified as differentially expressed in patients with pseudoexfoliation glaucoma (PEXG) compared to control groups, suggesting its potential role in this condition [PMC9454646]. Overall, SNORA77 plays a significant role in various biological processes and its expression levels have been found to be associated with different diseases and outcomes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGACUCCCUCAGCAUCCAGCGGGUGCUUUUUCGGUCUGCCAGUGAGCAUUCCAUGGUGCUGUGACCAUUUUGACCUCUCUAGGGUGAUGCAGCUGCCUGGGGACACAGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

2D structure Publications