Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens Small nucleolar RNA SNORA26 secondary structure diagram

Homo sapiens Small nucleolar RNA SNORA26 URS0000644C20_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA26: SNORA26 is a small nucleolar RNA (snoRNA) belonging to the H/ACA class [PMC3120706]. It is differentially expressed in various groups, including the WL groups [PMC7206725]. SNORA26 is located in the ANCR locus, specifically in intron 2 [PMC7591992]. It has also been found to be highly expressed in the PM10-treated group compared to the control group [PMC7801812]. SNORA26 has been identified as one of the genes amplified in more than one tumor genome, specifically in 8 tumors [PMC5423597]. Additionally, it is associated with copy number alterations (CNAs) predominantly determined in G1 and G3 tumors [PMC5423597]. Losses of SNORA26 have been observed and mapped to 3p21.1 [PMC5423597]. SNORA26 has been found to be co-expressed with other genes involved in various cellular processes such as cell differentiation, cell development regulation, and transcription regulation [PMC7541128]. It is also significantly enriched in pathways related to cancer, Rap1 signaling, Hippo signaling, MAPK signaling, sphingolipid signaling, TGF-β signaling, and Wnt signaling pathways [PMC7541128]. Furthermore, SNORA26 has been identified as one of the snoRNAs associated with sarcoma prognosis and included in a prognostic signature based on its expression value along with U3 snoRNA and other snoRNAs [PMC7541128][PMC9524901][PM8359088][PM9736786][PM8969249][PM6984369].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGCCGCCCACACAACCAAAUUAAAAAAUAACACAGAAGGGUAAGGUAAGUCUCCAUUAAACCCAGGAAAGAGACUGGAAAACUCCUCUUUGGAGCCUGUCUAUAGUCACAGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications