Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 12B (ENSG00000222365.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 12B (ENSG00000222365.1) URS0000643FAE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD12B: SNORD12B is a small nucleolar RNA (snoRNA) gene that has been implicated in various biological processes, including tumor suppression and breast cancer marker potential [1]. In a study, four snoRNA genes were found to be upregulated, including SNORD12B, SNORD42A, SNORA9, and SNORA71C [2]. These findings suggest that SNORD12B may play a role in cancer development and progression. Additionally, the study revealed that knockdown of MSI2 and SNORD12B combined with ZBTB4 overexpression could have clinical significance [3]. This suggests that targeting MSI2 and SNORD12B could be a potential therapeutic strategy. Furthermore, the study found that MSI2 and SNORD12B functioned as oncogenes in glioblastoma multiforme (GBM) cells [3]. Knockdown of MSI2 resulted in decreased expression of SNORD12B. This indicates a relationship between MSI2 and SNORD12B in GBM cells. Overall, these findings highlight the importance of snoRNAs like SNORD12B in cancer biology and suggest their potential as therapeutic targets for cancer treatment. References: 1. [PMC5765200] 2. [PMC7753709] 3. [PMC8114150]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUGGCAUAUAUGAUGACUUAGCUUUUUUCCCCGACAGAUCGACUAUGUUGAUCUAACUUUUCUAAGCCAGUUUCUGUCUGAUAUGCCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications