Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 108 (ENSG00000239014.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 108 (ENSG00000239014.1) URS0000640C62_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD108: SNORD108 is a C/D box small nucleolar RNA (snoRNA) gene located in the Prader-Willi syndrome (PWS) region on chromosome 15q11-13. It is one of the snoRNA genes present in this region, which includes SNORD64, SNORD107, SNORD109A, and SNORD109B [PMC6923197]. These snoRNAs are part of the PWS locus and are involved in the regulation of gene expression [PMC3077502]. SNORD108 is ubiquitously expressed, unlike SNORD109B and SNORD115 which are restricted to expression in neurons [PMC5522075]. It has been found to be co-expressed with other genes such as AC124312.1 and PWAR6 [PMC9582150]. The PWS locus in mice has a highly conserved synteny with the human PWS critical region on chromosome 15q11-13, but lacks orthologues for SNORD108, SNORD109A, and SNORD109B [PMC7038934]. The expression patterns of snoRNAs such as SNORD64, SNORD107, and SNORD108 are highly similar across different human tissues [PMC4171697]. These snoRNAs play a role in PWS as their absence contributes to the deleterious effects observed in patients with this syndrome [PMC7140444].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUUAAUGAUGAGAAUCAUUAUUUCUUGAAUUGGAUGACACUUUCCAUUCCUGCAAAGGGAGCGUGAGGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications