Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 116-13 (ENSG00000207137.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 116-13 (ENSG00000207137.1) URS000063EF58_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD116-13: SNORD116-13 is a small nucleolar RNA (snoRNA) that is part of the SNORD116 gene cluster. It has been inserted into the intron region of the pZW1 vector for experimental purposes [PMC4288147]. In a study using HeLa cells, overexpressed sno-lncRNA from pZW1-snoVectors was analyzed for its half-life. The cells were treated with actinomycin D, and the RNA was collected and analyzed using Northern blots [PMC4288147]. In postmortem posterior hypothalamus from individuals with Prader-Willi syndrome, the expression of SNORD116-13 was found to be decreased [PMC5315547]. Additionally, decreased expression of SNORD116-13 was observed in Lymphoblastoid cell lines (LCLs) from individuals with Alzheimer's disease compared to healthy controls. Conversely, LCLs exhibiting higher sensitivity to amyloid-beta (Aβ) showed increased expression of SNORD116-13 [PMC5315547]. The expression levels of several genes, including RGS2, DLGAP1, BCHE, DNASE1L3, SIRT1 and SARM1 were also presented in scatter plots [PMC5315547]. Microarray data for SNORD116-13 were validated using real-time PCR and showed higher expression levels in LCLs with high Aβ sensitivity and lower expression levels in AD LCLs compared to healthy controls [PMC5315547]. The real-time PCR analysis used the SYBR Green technique for both SNORD116-13 and a reference gene GUSB [PMC5315547]. Additionally, sno-lncRNA2 spans from SNORD116-13 to SNORD116-14 according to genomic coordinates provided in another study [PMC7536080].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGACCAAUGAUGACUUCCAUACAUGCAUUCCUUGGAAAGCUGAACAAAAUGAGUGGGAACUCUGUACUAUCAUCUUAGUUGAACUGAGGUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications