Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-524 precursor URS000063B6CA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR524: MIR524 is a microRNA that is involved in various biological processes [PMC6193703]. It is part of the C19MC miRNA gene cluster, which consists of 46 miRNA genes [PMC6193703]. In breast invasive carcinoma, the expression of MIR524 is downregulated by an overexpressed EGFR/myc axis, leading to the activation of the TGF-β, Notch, and Hippo pathways [PMC9966483]. MIR524 also plays a role in regulating gene expression through its interaction with other molecules [PMC3938728]. It has been found to downregulate targets such as OLR1, CPEB4, and DUSP1 [PMC3938728]. Additionally, MIR524 is regulated by EGFR through recruitment of a repressive histone modifier to its promoter region [PMC7766154].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCAUGCUGUGACCCUACAAAGGGAAGCACUUUCUCUUGUCCAAAGGAAAAGAAGGCGCUUCCCUUUGGAGUGUUACGGUUUGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications