Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small Cajal body-specific RNA 5 (ENSG00000252010.1, ENSG00000280652.1) secondary structure diagram

Homo sapiens (human) small Cajal body-specific RNA 5 (ENSG00000252010.1, ENSG00000280652.1) URS00006375AD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SCARNA5: SCARNA5 is a type of small nucleolar RNA (snoRNA) that is strongly positively correlated with intratumoral T cell-mediated cytotoxicity by granzyme A [PMC6294694]. It is one of the various sdRNAs, along with SNORD6 and SNORD114-22, that exhibit this correlation [PMC6294694]. PD-L1, on the other hand, is an indicative biomarker for checkpoint blockade immunotherapy and has been successfully used in guiding major clinical trials of immunotherapy [PMC6294694]. In a study that examined the expression levels of various snoRNAs in human tissues, SNORD116 expression levels were found to correlate with the expression of U6 snRNA and in some tissues with SCARNA5 [PMC4171697]. SCARNA5 was also found to be highly to medium abundant in the 20 human tissues tested [PMC4171697]. In another study, SCARNA5 was one of the reference genes used for normalization of data using geNorm [PMC8271217]. Additionally, an association between SCARNA5 expression level and a certain outcome was observed when dividing the expression level into two groups by median [PMC9803687].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCGAUGAUGAUUGGUAAAAGGUCUGAUUGCACUGAAUGUCACGGUCCCUUUGUUGCCCUCAACUCCCAGCAGCCCAUUUUUUCCCUCCCGUCACAUUUAAGUCAUGUGUAUGGGAUCAUGGAGCAGCUGAUAAUUUGGGAUUCUGUCAGUGUGUGUUUCUGAGAGUGAUCGGCUCACAGCUGACGAGUAUCCAACAAAACCAGUUACACAGGAGACUGACGAGUGGCAGUCAUGGGUGUGAUGGUGCAUGAUCUCAAGUUUUCAAUCUGAGACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications