Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 116-4 (ENSG00000275529.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 116-4 (ENSG00000275529.1) URS0000632CF2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD116-4: SNORD116-4 is a snoRNA that is upregulated in post-therapeutic LACC samples compared to pre-therapeutic LACC samples, along with other snoRNAs such as SNORD116-2, SNORD107, SNORD61, SNORD112, and SNORD109A [PMC6900565]. The levels of SNORD116s not included in any sno-lncRNAs were assessed using primer pairs designed specifically for SNORD116-4 [PMC9896466]. High expression of SNORD116-4 is associated with poor prognosis in ovarian cancer patients [PMC6686521]. However, it was not highly expressed in ovarian cancer patients with OS [PMC6686521]. The expression of SNORD89 and SNORD116-4 predicts poor prognosis in ovarian cancer patients [PMC6686521]. In stage III ovarian cancer patients, high expression of SNORD116-4 is associated with poor prognosis, while in stage IV patients it is associated with better prognosis [PMC6686521]. However, the high expression of SNORD116-4 does not significantly affect the 5-year survival rate of stage III and IV ovarian cancer patients [PMC6686521].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAUCGAUGAUGAGUCCCCCCAAAAAAACAUUCCUUGGAAAAGCUGAACAAAAUGAGUGAAAACUCAUACCGUCGUUCUCAGCGGAACUGAGGUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications