Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 52 (multiple genes) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 52 (multiple genes) URS0000632610_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD52: SNORD52 is a C/D box snoRNA that has been implicated in hepatocellular carcinoma (HCC) progression [PMC7415794]. In a study, the effects of SNORD52 knockdown on HCC cell lines HCCLM9 and HCCLM3 were investigated [PMC7415794]. The results showed that the proteasome inhibitor MG-132 could reverse the changes in CDK1 protein levels caused by SNORD52 knockdown, while cycloheximide (CHX) did not have this effect [PMC7415794]. Flow cytometric analysis revealed that SNORD52 knockdown led to a decrease in the proportion of cells in the G0/G1 and S phases, but an increase in the proportion of cells in the G2/M phase [PMC7415794]. Interestingly, SNORD52 was found to be bound by nucleophosmin 1 (NPM1), a phosphoprotein residing in nucleoli. This binding was reported for other C/D box snoRNAs as well, including SNORD42A, SNORD15, SNORD47, SNORD58, and SNORD104 [PMC8629011]. To further understand the role of SNORD52 in HCC progression, gain-of-function and loss-of-function experiments were conducted to investigate its effects on malignant features of HCC cell lines [PMC7415794].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGAAUGAUGAUUUCACAGACUAGAGUCUCCGAUGCUGGUCAUGAUGUCAAAACUAAGUUCUGACUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

2D structure Publications