Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) snoRNA (ENSG00000212168.1) URS000062D18D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD78: SNORD78 is a small nucleolar RNA (snoRNA) that has been studied in various cellular contexts. Co-localization assays using in situ hybridization (ISH) combined with immunofluorescence (IF) have shown that SNORD78, along with ZFAS1 and SNORD12C, is co-distributed and co-located with NOP58 within the cell nucleus of HCT116 cells [PMC7243338]. In a study involving matched normal and prostate cancer samples, the expression of snoRNAs including SNORD44, SNORD78, SNORD74, and SNORD81 was validated [PMC6163368]. The study included a cohort of 106 patients in different disease stages. The overexpression of SNORD78 did not have any significant effects on the expression level of GAS5 [PMC4472183]. SNORD78 is a snoRNA that has been found to co-localize with NOP58 within the cell nucleus [PMC7243338]. It has also been studied in prostate cancer samples where its expression was validated [PMC6163368]. Additionally, overexpression of SNORD78 did not affect the expression level of GAS5 [PMC4472183].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGUAAUGAUGUUGCUCAAAUAUCUGACCUGAAAUGAUUAUAUAGACCAAUUUAAUACUGAAGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications