Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 87 (ENSG00000254341.2) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 87 (ENSG00000254341.2) URS000062C5D9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD87: SNORD87 is a small nucleolar RNA (snoRNA) that is abundantly expressed in induced pluripotent stem cells (iPSCs) [PMC3168439]. Its expression levels are often normalized to the geometric mean of other small noncoding RNAs, such as Rnu6, Snord65, Snord68, and Rny1, to ensure stability [PMC3184962]. SNORD87 has been found to be differentially expressed in various contexts, such as in female C57BL/6 mice after exposure to SDS [PMC9698544] and in aging and osteoarthritis [PMC7326970]. It is also associated with copy number amplification in colorectal cancer (CRC) [PMC7136466] and has been identified as a potential oncogene with poor prognosis in CRC patients [PMC6332483]. SNORD87 plays a role in the modification of other RNAs, such as 28S rRNA and small nuclear RNAs (snRNAs), through guiding RNA modifications [PMC3349704] [PMC5125095]. Its expression levels have been found to decrease after cells exit pluripotency [PMC8713755]. SNORD87 has different gene numbers across species, with four genes in Xenopus and zebrafish each, two genes in chicken, and a single gene in humans [PMC3349704].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUGGCACAAUGAUGACUUAAAUUACUUUUUGCCGUUUACCCAGCUGAGGUUGUCUUUGAAGAAAUAAUUUUAAGACUGAGAUGCCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications