Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 98 (SNORD98) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 98 (SNORD98) URS000062C164_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD98: SNORD98 is a type of small nucleolar RNA (snoRNA) that is involved in various biological processes [PMC4159348]. The sdRNAs of SNORD98 contain only the box D, and a small percentage of sdRNA reads contain a guide RNA sequence [PMC4159348]. In a study on laryngeal samples, it was observed that the expression of SNORD98, along with other miRNAs, was upregulated in malignant samples compared to normal samples [PMC7913204]. SNORD98 has also been shown to have binding affinity for specific positions in human 18S rRNA [PMC5733568]. In another study, it was found that pretreatment with metformin increased the expression of SNORD98 [PMC9857533]. Additionally, SNORD98 expression was found to be increased following IL-1β treatment [PMC7326970]. However, no significant change in expression was observed for SNORD98 in another study comparing different conditions [PMC7326970]. Furthermore, it has been shown that the abundance of SNORD98 does not vary between different cell types or conditions [PMC8336889]. Overall, these findings highlight the diverse roles and regulation of SNORD98 in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGUUAUGAUGUGUGUAAAUCCUAUUCCAUUGCUGAAAUGCAGUGUGGAACACAAUGAACUGAACUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications