Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) U8 small nucleolar RNA (ENSG00000202269.1) secondary structure diagram

Homo sapiens (human) U8 small nucleolar RNA (ENSG00000202269.1) URS000062AE00_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

U8: U8 is a metazoan-specific C/D box snoRNA that is involved in ribosomal biogenesis and aids in rRNA processing [PMC9703455]. Knockdown of DDX5 and DDX17 leads to increased cellular levels of U8 snoRNA, and impairs its dissociation from pre-ribosomes [PMC9196750]. NOP2/NSUN1, a protein, interacts with U3 and U8 snoRNPs in the nucleoplasm or nucleolus, suggesting its involvement in box C/D snoRNPs biogenesis [PMC9561284]. Abnormal expression of U3 and U8 snoRNAs has been observed in BC cells [PMC8005115]. The Xenopus protein has been shown to efficiently bind to U8 snoRNA through EMSA and UV-mediated RNA-protein cross-linking experiments [PMC2566886]. Mutations in the U8 gene have been found outside regions of known functional importance [PMC8993069]. The unusual values of ε and ζ in U7, U14, and U15 form extended structures with U8 at the 3' side [PMC2425495]. Probes targeting the urease gene have been designed for specific detection of U. urealyticum (U3) and U. parvum (U8) using overlapping species-specific probes [PMC4105565]. While the functions of U3 or U8 are not fully understood, their high abundance suggests they may have non-conventional functions within cells [PMC5312328]. The effect of depleting either U3 or U8 on nucleolar structure was found to be dependent on the presence of p53 protein [PMC5312328]. Proteins were pre-incubated with labeled 4-thioU RNA for further analysis involving UCBSV (U8) from a field sample collected in Uganda's Mayuge district [PMC5093738]. ChromHMM states were converted into numerical values based on their openness, with U8 being one of the states [PMC8891870].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAUCAGGUGGGAUCAUCCUUACCUGUUUCUCCUUUUGGAGGGCAGAUCAGAACAUGAUGAUUGGAGAAGAAUGAAACGUGAUUAAUAACUCUGUGUAAUCAGGCCUUGCAGCACCCCAAUUGAGCCUUUCUGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications