Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 124 (SNORD124) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 124 (SNORD124) URS000062A15C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD124: SNORD124 is a snoRNA (small nucleolar RNA) that has been found to have different curated coordinates from its known annotation, along with several other snoRNAs such as SNORD81, SNORD49B, SNORD126, SNORD125, SNORD123, SNORD121A, SNORD11B, SNORD127, SNORD58C, SNORD12B, SNORD111B, SNORD105B, and others [PMC4914119]. In a study on hepatocellular carcinoma (HCC), the expression of snoRNAs including SNORA59B and the negatively correlated expression of snoRNAs such asSNORA11 andSNORA16B were found to be related to the prognosis of HCC [PMC9524901]. Additionally,SNORA11,SNOR124,andSNOR46 were identified as key snoRNAs with high diagnostic and prognostic efficacy in HCC [PMC9524901]. The expression ofSNOR124 was found to be related to the infiltration of Th17 cells and TFH cells in HCC [PMC9524901]. In another study on breast cancer (BC),SNOR124 was associated with HER2 positive tumors [PMC9803687]. Furthermore,SNOR124 was found to be associated with periodontal traits and mapped to several genes including IL1RN and IL1B [PMC6375219]. Overall,SNOR124 has been implicated in various diseases such as HCC and BC. However,further research is needed to fully understand its role in these diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUCUCAAGGAAGGGAUGAUGUUCCAGUUGAGACUCAAGAAAAGGAUUCUGAGCCUCAGAGCUUUGAAGGAGCCACUUGGUCCCUGACCUUCCUAGAGGCAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications