Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) snoRNA (ENSG00000221639.1) secondary structure diagram

Homo sapiens (human) snoRNA (ENSG00000221639.1) URS0000627FDE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA3: SNORA3 is a small nucleolar RNA (snoRNA) that is overexpressed in tumor-initiating cells and lung tumors [PMC6563001]. Its higher expression in human lung tumors is associated with a lower overall survival rate in lung cancer patients [PMC6563001]. SNORA3 is one of the snoRNAs that are deregulated in cancer, with high expression observed in metastatic breast cancer patients and cell lines [PMC8445368]. It has been found to be overexpressed in tumor-initiating cells and associated with poor prognosis in non-small cell lung cancer (NSCLC) patients [PMC7140444]. SNORA3, along with SNORA42, has been identified as one of the snoRNAs that are highly expressed in NSCLC tumor-initiating cells compared to differentiated lung cancer cells [PMC4029979]. It has also been shown to be overexpressed in lung cancer stem cells and inversely associated with survival in NSCLC patients [PMC6629867]. SNORA3 has been functionally characterized to determine its role in regulating stemness of lung tumor-initiating cells [PMC4029979]. Additionally, SNORA3 has been found to have a precursor confirmed as a small nucleolar RNA-microRNA (sno-miRNA) with miRNA-like function [PMC5814818]. References: - PMC6563001: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6563001/ - PMC8445368: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8445368/ - PMC7140444: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7140444/ - PMC4029979: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4029979/ - PMC6629867: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6629867/ - PMC5814818: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5814818/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUGAGACUAGAGUCACAUCCUGACACGGCUCUUCUCCAAUGUGCUGGAGUCCUCAGCAUCUGCUGGUCUUGAUUCACUGAUGGGGGCAACCAGUGUCCCCUUAAGUGUCCGGGCAGAAACAUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications