Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) snoRNA (ENSG00000212461.1) secondary structure diagram

Homo sapiens (human) snoRNA (ENSG00000212461.1) URS0000625E1C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA17: SNORA17 is a small nucleolar RNA (snoRNA) that has been identified in various studies [PMC4846597][PMC6423644][PMC5679375][PMC8522698][PMC8446661][PMC3747266][PMC5454292][PMC4755013][PMC9025840][PMC7154078][PMC6044101][PMC7801812][PMC5573159][PMC6381762][PMC2832892][PMC9932081][PMC7812872][PMC7244715]. It has been found to be one of the top upregulated genes in different contexts, such as in gene expression profiling studies and during oocyte maturation [PMC5679375][PMC6423644]. SNORA17 is also known to be unstable in heterologous cell systems, similar to other abundant snoRNAs like SNORA39 and SNORA17 in Drosophila and humans, respectively [PMC8522698]. It has been associated with nucleolar functions, xenobiotic enzyme activity, ubiquitin peptidase activity, and circadian functions [PMC8446661]. SNORA17 is thought to be encoded by the small nucleolar RNA host gene 7 (SNHG7) and is known to modify 28S rRNA [PMC3747266][PMC5454292]. It has also been found to overlap with other snoRNAs like SNORA43 [PMC5454292]. Additionally, SNORA17 has been identified as one of the differentially expressed snoRNAs following exosome treatment and prenatal T treatment [PMC6044101][PMC9932081]. The expression of SNORA17 has also been observed in various species such as humans, rhesus monkeys, mice, chickens, and L. bilineata [PMC2832892][PMC6381762][PMC7154078][PMC9932081].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUUUACAUAGCGCUGCAGAUGUGGCUGCUGUGUCACAUUUGUGUUAUUAGGUGGCAGAGAGAAGAGAGGCUAUGUCUAUGCUCAGUGUUCUGCCCCAUGAACAUUUGAAUGUUUAAUAGUCAGACACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications