Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-197-3p URS000061E740_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-197: Hsa-mir-197 is a specific microRNA that was investigated in a study using in situ hybridizations (ISH) on biopsies of psoriatic lesion skins, uninvolved skins, and normal skins [PMC3110257]. The study also examined other microRNAs such as hsa-miR-99a, hsa-miR-150, and hsa-miR-423 [PMC3110257]. Another set of assays was designed for further studies, which included the detection of RPS8, ZNF106, RNF-167, hsa-miR-29a, hsa-mir-197, and hsa-miR-297 [PMC3764000]. In the study mentioned above [PMC3110257], the researchers used specific LNA probes for the detection of hsa-mir-197 in psoriatic lesion skins. The purpose was to investigate the expression levels of this microRNA in different skin conditions. The results of this study could provide insights into the role of hsa-mir-197 in psoriasis. In addition to studying psoriasis-related conditions [PMC3110257], further assays were designed to investigate other genes and microRNAs. These assays included the detection of RPS8, ZNF106, RNF-167 along with other microRNAs such as hsa-miR29a and hsa-miR297 [PMC3764000]. These additional assays could provide a more comprehensive understanding of gene expression patterns and potential regulatory mechanisms involved. Overall, these studies highlight the importance of investigating specific microRNAs like hsa-mir-197 in various skin conditions such as psoriasis. By understanding their expression patterns and potential roles in disease pathogenesis or regulation mechanisms like gene expression patterns or regulatory mechanisms involved can be better understood.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCACCACCUUCUCCACCCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Ateles geoffroyi age-miR-197
  2. Bos taurus (cattle) bta-miR-197
  3. Callithrix jacchus cja-miR-197
  4. Canis lupus familiaris cfa-miR-197
  5. Capra hircus (goat) chi-miR-197-3p
  6. Cavia porcellus (domestic guinea pig) cpo-miR-197-3p
  7. Cervus elaphus (red deer) cel-miR-197
  8. Equus caballus eca-miR-197
  9. Gorilla gorilla gorilla ggo-miR-197 (MIR197)
  10. Gorilla gorilla (western gorilla) ggo-miR-197
  11. Macaca mulatta (Rhesus monkey) mml-miR-197-3p
  12. Microcebus murinus (gray mouse lemur) mmr-miR-197
  13. Oryctolagus cuniculus ocu-miR-197-3p
  14. Otolemur garnettii (small-eared galago) oga-miR-197
  15. Pan paniscus ppa-miR-197
  16. Pan troglodytes (chimpanzee) ptr-miR-197
  17. Pongo pygmaeus (Bornean orangutan) ppy-miR-197
Publications