Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 36A (SNORA36A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 36A (SNORA36A) URS000061AA47_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA36A: SNORA36A is a small nucleolar RNA (snoRNA) that is not associated with high-grade serous ovarian cancer (HGSC) [PMC8759569]. It is located within the introns of the DKC1 gene [PMC8759569]. SNORA36A has been found to be down-regulated in chronic lymphocytic leukemia (CLL) compared to tonsillar B-cells and GC B-cells [PMC3766210]. It is also associated with the microRNA gene hsa-mir-664b and the protein-coding host gene DKC1 [PMC3675212]. SNORA36A, along with SNORA36C, is involved in the modification of 18S rRNA [PMC4824560]. The sequence of SNORA36A within introns 8 and 12 has been found to be intact [PMC3088476]. SNORA36A has a negative correlation with monocytes, along with genes TRAV10, CD22, and ANK3, while DNASE1L3 and ACP3 have a positive correlation with monocytes [PMC8445487]. It is also identified as one of the common hub genes in further analysis [PMC8445487]. In peripheral blood B-cells, SNORA36A expression is reduced compared to GC B-cells and other B-cell subsets such as naïve, marginal zone, memory B-cells from tonsils [PMC10050728] as well as CLL cells compared to GC B-cells suggesting that CLL cells are not from GC origin[ PMC9219770]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCAAAGUGUUGAGUUCAGUCCAGGGCAGCUUCCCUGUUCUGUUAAUUAAACUUUGGGACAUUAAAAUGGGCUAAGGGAGAUGAUUGGGUAGAAAGUAUUAUUCUAUUCAUUUGCCUCCCAGCCUACAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

2D structure Publications