Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Leu (UUA/G) 1 (MT-TL1) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Leu (UUA/G) 1 (MT-TL1) URS000061A10B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TL1: MT-TL1 is a gene that encodes tRNA-leucine and is located in the mitochondrial DNA (mtDNA) [PMC8306397]. Mutations in the MT-TL1 gene have been found to be responsible for a significant number of patients with mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS) [PMC8306397]. In a study, the odds ratio (OR) for developing cardiovascular disease (CVD) during follow-up was found to be 1.30 (95% CI 1.05–1.61) for a specific mutation at nt3254 of MT-TL1 [PMC7026975]. This OR was adjusted for various factors such as age, BMI, fasting blood glucose, cholesterol ratio, systolic blood pressure (SBP), and diastolic blood pressure (DBP) [PMC7026975]. Additionally, other mutations in mitochondrial genes such as nt6807 of MT-CO1 and nt9444 of MT-CO3 were also associated with increased risk of developing CVD [PMC7026975]. These findings highlight the importance of genetic variations in mtDNA genes like MT-TL1 in the development of CVD [PMC7026975]. Further research is needed to better understand the mechanisms by which these mutations contribute to cardiovascular risk [PMC7026975].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUAAGAUGGCAGAGCCCGGUAAUCGCAUAAAACUUAAAACUUUACAGUCAGAGGUUCAAUUCCUCUUCUUAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Cinara cedri tRNA.Leu
  2. Cloning vector pRS316-1B9 tRNA-Leu
  3. Homo sapiens neanderthalensis transfer RNA-Leu
2D structure Publications