Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ASMTL antisense RNA 1 (ASMTL-AS1) URS000060F735_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ASMTL-AS1: ASMTL-AS1 is a gene that has been studied in relation to survival in patients with gastric cancer, using Kaplan-Meier analysis and the log-rank test to demonstrate the correlation between survival and ASMTL-AS1 expression [PMC8805870]. However, further research is needed to validate the prognostic value of ASMTL-AS1 in triple-negative breast cancer (TNBC), particularly with larger sample sizes [PMC8130432]. Additionally, investigating whether ASMTL-AS1 can be detected in body fluids such as sweat, urine, blood, or exosomes may lead to the development of a non-invasive diagnostic biomarker for TNBC [PMC8130432].

Targeting miRNAs 1 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACAGGCCGGGAACAGCAGCUGGGAGCGGAGCACGGGGGAAACGUGGAUGCGCUGAGCUCCCUACAACCGCAGUGAGCAUGUGCCCAGGAGGGCCUCACGGGGUGGGUGUGAGUCUGGCCUGCCUGGGCUCGGGGUGGGGGGUGUUUACAGACGCAUUUCAGCCCCGCAGCAGGGGCUGGGGAGGUCCCGCUCGUGACAGUCUCUGCACCAAGGCAGGAGAGAUGGAAGCCGCCCAGAGAACUGCCACUCCAUAGCCUGUGGGCAUCCAGGGGUGAGCGGCAGCGAUGGCGCCCCAUGGAGGAAACACACUGGAAAUCGUGCAGAAGAUGGGAAGAUGCAGGCUGGAGUGCGGAGAAGGACUGAGACCCUGCCUGGUAGACGGCACCGUCACAGCAGCCGUCUGCCUGCUAGGAGGAGCGUCUCCACCAGCAGCAGGCCGGCCCCUGAGGGAGACAGCAGAGAGCUGGAGUCCUGGCCAGCCAGGCGGGGAUCCUUCAGCAGGACACAGGGGACACAGCAGGCAACAGGAGCUCAGAACGCUCUCGGCGACCCUGCUGAGUAACUUGUGGACUUUGUCGUCUGGCCAGUCAUGCAGGAUCCGGCACAGGACGUACAGCUCAGCGCUGGGGAGGGGGUCCCUGAAAAAGUCACCUGGUUUAAAGACAAAACGAGAUACGUCCGUCAGAGACAGAAGAGGAGACAGACACAGAGGAGAAGGCCACGUGGAGACGGAGGCAGAGACUGGAGUGAUGCGGCCACAAGCCCAGGGACGCCUGGAGCCCCCAGGAGCUGGAAGAGGCGGGAAGGAUCCUCCCCUAGAGCCUCUCAGAAAGAAUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications