Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-7705 URS000060B2B9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-7705: Hsa-mir-7705 is a microRNA that has been studied in various types of cancer, including bladder urothelial carcinoma and gastric cancer. In bladder urothelial carcinoma, high expression levels of hsa-mir-7705 have been associated with shorter survival times [PMC5588142]. It has also been identified as one of the three best independent prognostic miRNAs for bladder urothelial carcinoma [PMC5588142]. In gastric cancer, hsa-mir-7705 has been found to be upregulated and to have a tumor suppressor role [PMC9816570]. It has also been shown to have a binding effect on hsa_circ_0061276, a circular RNA [PMC9816570]. Furthermore, the expression of hsa_circ_0061276 was significantly decreased after overexpression of hsa-mir-7705 in gastric cancer cells [PMC9816570]. In addition to its role in cancer, hsa-mir-7705 has also been implicated in normal breast tissue, where it was found to have allelic-specific binding to the reference allele of rs4808616 in the ABHD8 gene [PMC7018948]. These findings highlight the potential importance of hsa-mir-7705 as a prognostic factor and therapeutic target in various types of cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUAGCUCAGAAUGUCAGUUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications