Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1249-3p URS000060AABB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1249: Hsa-mir-1249 is a microRNA gene that is conserved in various sequences of NS1 genes in type 1 [PMC3521223]. It is a single-exon gene that has been screened by PCR and Sanger sequencing [PMC4549933]. Hsa-mir-1249 has been identified as one of the 16 miRNAs that contribute to the best classification accuracy [PMC2889897]. In infants with biliary atresia, hsa-mir-1249 expression levels were significantly lower [PMC4754688]. Hsa-mir-1249, along with other differentially expressed miRNAs, has been selected as a putative biomarker for further validation [PMC4754688]. It has a predicted target gene, GPR64, which is related to G-protein coupled receptor activity [PMC4754688]. Hsa-mir-1249 was found to be down-regulated in kidney tissue samples of patients with membranous nephropathy compared to healthy controls [PMC8610666]. It is one of the miRNAs identified in association with various genes related to survival differences and expression differences in TCGA database analysis [PMC7917321]. Hsa-mir-1249 was also found to have indels associated with microsatellite instability (MSI) in miRNA genes [PMC7648123].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACGCCCUUCCCCCCCUUCUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus bta-miR-1249
  2. Canis lupus familiaris cfa-miR-1249
  3. Capra hircus (goat) chi-miR-1249
  4. Cervus elaphus cel-miR-1249
  5. Cricetulus griseus cgr-miR-1249
  6. Dasypus novemcinctus dno-miR-1249-3p
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-1249_3p (mature (guide))
  8. Eptesicus fuscus efu-miR-1249
  9. Gorilla gorilla gorilla ggo-miR-1249 (MIR1249)
  10. Gorilla gorilla (western gorilla) ggo-miR-1249
  11. Macaca mulatta (Rhesus monkey) mml-miR-1249
  12. Mus musculus mmu-miR-1249-3p
  13. Oryctolagus cuniculus (rabbit) ocu-miR-1249-3p
  14. Pan troglodytes ptr-miR-1249
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-1249
  16. Rattus norvegicus rno-miR-1249
  17. Sus scrofa ssc-miR-1249
Publications