Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-379-5p URS000060A1F4_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUAGACUAUGGAACGUAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Bos taurus bta-miR-379
  2. Canis lupus familiaris cfa-miR-379
  3. Capra hircus (goat) chi-miR-379-5p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-379-5p
  5. Cervus elaphus cel-miR-379
  6. Cricetulus griseus cgr-miR-379
  7. Dasypus novemcinctus dno-miR-379-5p
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P7_5p (mature (co-guide))
  9. Equus caballus eca-miR-379
  10. Gorilla gorilla gorilla ggo-miR-379 (MIR379)
  11. Gorilla gorilla (western gorilla) ggo-miR-379
  12. Macaca mulatta (Rhesus monkey) mml-miR-379-5p
  13. Mus musculus mmu-miR-379-5p
  14. Oryctolagus cuniculus (rabbit) ocu-miR-379-5p
  15. Ovis aries (sheep) microRNA miR-379
  16. Pan paniscus ppa-miR-379
  17. Pan troglodytes ptr-miR-379
  18. Pongo pygmaeus (Bornean orangutan) ppy-miR-379
  19. Pteropus alecto pal-miR-379-5p
  20. Rattus norvegicus rno-miR-379-5p
Publications