Homo sapiens (human) small Cajal body-specific RNA 8 (SCARNA8)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small Cajal body-specific RNA 8 (SCARNA8) URS0000608804_9606

131 nucleotides
9 databases (ENA, Ensembl, GeneCards, HGNC, MalaCards, RefSeq, Rfam, snoDB, snOPY)
Found in 1 other species
64 publications
1. sncRNA
2. snoRNA
3. scaRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SCARNA8: SCARNA8 is an intronic RNA that is part of a signature that includes various other intronic RNAs such as SNORA12, SNORA22, SNORA27, SNORA56, SNORA64, SNORA69, SNORA70, SNORA74A, SNORA80, SNORA84, SNORD1A, SNORD1B, SNORD8, SNOR18, SNORD30, SNORD32A, SNORD34, SNORD105B, SNORD110 [PMC8629011]. In order to investigate the pseudouridylation guide capabilities of SCARNA8 and other intronic RNAs such as SCARNA1, SCARNA14, and SNORA57, the single-copy genes of these RNAs were deleted using CRISPR-Cas9 genome editing in human HAP1 cells [PMC8763049].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGGGAGGCUGAUACACAAAUUGGGCUGAAAUACUGCUCUACUUGUCACCAUGCCUCCCUAGAAUAAACUGCCUUUUGAUGACCGGGACGAAUUGAGUGAAAUCGUAACGGACAGAUACGGGGCAGACAGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.