Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 16A (SNORA16A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 16A (SNORA16A) URS00006020BE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA16A: SNORA16A is a small nucleolar RNA (snoRNA) that is encoded by a gene approximately 1,867 bases long. It is one of the four snoRNAs (SNORA66, SNORA61, SNORA16A, and SNORD99) produced from the spliced introns of this gene [PMC10152875]. A study investigating the expression of snoRNAs in hepatocellular carcinoma found that knockdown of SNHG12 did not significantly affect the expression of snoRNAs including SNORA16A [PMC7154078]. Another study examining gene expression in myocardial infarction (MI) found that the expression level of SNORA16A was decreased on the first day of MI and increased thereafter [PMC10020602]. Additionally, a chip analysis identified SNORA16A as one of the 24 targets included in the chip's primers [PMC6308291]. These references provide information on various aspects related to SNORA16A, including its type as an snoRNA, its expression patterns in different conditions such as hepatocellular carcinoma and MI, and its inclusion in primer targets for chip analysis.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGCCCUUAUCGAAGCUGCAGCUGCUUCCGCAUAGCUGCUGUGGUCAAAAAGGAGCCCAGAGUGACAGUUUUCCUUGACGGUCGCCGUUCUGUUUGUUGUAACUGAUCUGCAACAUUUUGGGAAAAUACAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications