Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 35B (SNORD35B) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 35B (SNORD35B) URS00005F7BA1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD35B: SNORD35B is a small nucleolar RNA (snoRNA) that has been implicated in various diseases, including head and neck squamous cell carcinoma (HNSCC) and leukemia. In HNSCC, high expression levels of SNORD35B have been associated with a lower survival rate among patients [PMC5867855]. Additionally, SNORD35B has been identified as a prognostic factor for HNSCC, independently of established clinical risk parameters [PMC4436665]. In pediatric B-cell precursor acute lymphoblastic leukemia (BCP-ALL), elevated expression levels of SNORD35B have been linked to disease relapse [PMC8677010]. Similarly, in chronic B-cell lymphocytic leukemia (CLL), dysregulation of SNORD35B has been observed in response to proliferation and has potential as a biomarker for distinguishing between normal B-cells and CLL cases [PMC10050728]. Furthermore, SNORD35B has been found to be upregulated in relapsed BCP-ALL patients compared to those without relapse [PMC9413531]. In terms of its function, SNORD35B is involved in the methylation of 28S ribosomal RNA at residue C4506 [PMC4436665][PMC6466398]. Overall, the dysregulation and prognostic significance of SNORD35B make it an important target for further research in various diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCAGAUGAUGUUUGUUUUCACGAUGGUCUUCAGAUGCCCACGUGGGCACUGCUGAGAAAGCCACUUGGUAAAACUGAUGCCGGAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications