Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 14B (SNORA14B) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 14B (SNORA14B) URS00005F2496_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA14B: SNORA14B is a small nucleolar RNA (snoRNA) that has been identified in various studies. It has been found to be present in exosomes derived from pancreatic cell lines [PMC7461500]. In different exosome populations, SNORA14B has been shown to be enriched in Ep-CAM-Exos [PMC7461500]. SNORA14B, along with other snoRNAs, was detected using fluorescence in situ hybridization in pancreatic cell lines [PMC6360365]. It was also found to be present in CD63-positive exosomes isolated from the culture medium of pancreatic cell lines [PMC6360365]. SNORA14B has been investigated as a potential diagnostic marker for differentiating pancreatic ductal adenocarcinoma (PDAC) patients from control patients without pancreatic disease [PMC6360365]. In PDAC cells, SNORA14B was found to bind IGF2BP3 [Taniuchi et al., 2014a]. Additionally, SNORA14B was encapsulated in exosomes isolated from the serum of pancreatic cancer patients and conditioned medium of pancreatic cell lines [PMC9638531]. It has also been analyzed in circulating extracellular vesicles (EVs) from patients with PC and controls [PMC8200014]. The expression of SNORA14B has shown diagnostic potential for early-stage PDAC with an AUC value of 0.875 [PMC8750069] and 0.862 [PMC8424929]. Overall, these studies highlight the presence and potential diagnostic value of SNORA14B as a snoRNA associated with PDAC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCAUUCUUAAACCCUCUUGGUAGCUUCGUUCUAAGUGCUUCCAAGAUAUGAGUGAAUGCUAUAGAAAUUGCAGGGGAGUCCAAAGGGCUGCGCUUCUCCCGUGGCUCAGUCUUAUUUCAUACCUGCGACAUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications