Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-507 URS00005E6F45_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-507: Hsa-mir-507 is a microRNA that is significantly down-regulated in mutant types, as observed through qPCR analysis [PMC5226495]. The luciferase activities of certain genes, such as GLI3, PIK3C2A, ADAM17, and PRDX1, were significantly increased in the mutant types of hsa-mir-507 [PMC5226495]. Hsa-mir-507 is part of a miRNA cluster associated with Xq27 that displays testis-specific expression in healthy tissues [PMC7351945]. Hsa-mir-507 and hsa-miR-511 were predicted to regulate SNAI2 [PMC8027762]. Hsa-mir-507 is one of the miRNAs that interact with DElncRNA MEG3 [PMC6522832]. Hsa-mir-507 is part of a ceRNA network involving lncRNAs and mRNAs such as CDK6 and TFAP2C [PMC10040182]. The hsa-mir-507 precursor was amplified into a retroviral transfer plasmid for further analysis [PMC5095036]. Hsa-mir-507 does not modulate any pathways or target genes according to the reference database TarBase Version 7.0 of DIANA-mirPath for miRNAs such as hsa-miR-508-3p and hsa-miR2103p [PMC6423615]. The predicted target miRNAs for hsa_circ_0001445 include hsa-mir-507 [PMC10043405]. Finally, hsa_mir-507 was identified as one of the key driver miRNAs associated with certain protein complexes in thyroid cancer [PMC5793195].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUUGCACCUUUUGGAGUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Macaca mulatta (Rhesus monkey) mml-miR-507
  2. Pan troglodytes ptr-miR-507
  3. Pongo pygmaeus ppy-miR-507
  4. Rhinopithecus bieti pbi-miR-507
  5. Symphalangus syndactylus (siamang) ssy-miR-507
Publications