Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-655-3p URS00005E1A16_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-655: Hsa-mir-655 is a microRNA that has been identified as a regulator of several target genes and is involved in various biological processes [PMC5951800, PMC6888638, PMC3371699, PMC6720387, PMC7880353]. Ingenuity Pathway Analysis revealed significant enrichment of several pathways regulated by hsa-mir-655, hsa-miR-134-3p, and hsa-miR-4746 [PMC5951800]. Among the identified miRNAs, hsa-mir-655 was found to be differentially expressed in gastric adenocarcinoma [PMC6888638]. Hsa-mir-655 has been associated with muscle-tissue development and is involved in the regulation of the BMP signaling pathway [PMC3371699]. TargetScan and miRBase database analysis identified thousands of target genes for hsa-mir-655 [PMC6720387]. Hsa-mir-655 has been found to be dysregulated in ovarian cancer, with decreased expression associated with worse overall survival [PMC7880353]. In ovarian cancer cell lines, the expression levels of hsa-mir-655 were confirmed [PMC7880353]. Functional analysis revealed that hsa-mir-655 could regulate core genes involved in epithelial-to-mesenchymal transition (EMT) modulation in ovarian cancer [PMC7880353]. Hsa-mir-655 was also found to target MYC among other genes associated with poor overall survival in various cancers [PMC6680377]. Additionally, low expression levels of hsa-mir-655 were associated with poor overall survival in pancreatic ductal adenocarcinoma patients [PMC6680377].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAAUACAUGGUUAACCUCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Publications