v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-458a-3p URS00005E194D_9031

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUAGCUCUUUGAAUGGUACUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Alligator mississippiensis (American alligator) ami-miR-458-3p
  2. Anolis carolinensis aca-miR-458
  3. Chrysemys picta bellii Cpi-Mir-458_3p (mature (guide))
  4. Chrysemys picta cpi-miR-458-3p
  5. Columba livia cli-miR-458-3p
  6. Danio rerio dre-miR-458-3p
  7. Gekko japonicus Gja-Mir-458_3p (mature (guide))
  8. Ictalurus punctatus (channel catfish) ipu-miR-458
  9. Latimeria chalumnae Lch-Mir-458_3p (mature (guide))
  10. Lepisosteus oculatus (spotted gar) Loc-Mir-458_3p (mature (guide))
  11. Microcaecilia unicolor Mun-Mir-458_3p (mature (guide))
  12. Ophiophagus hannah oha-miR-458-3p
  13. Ornithorhynchus anatinus oan-miR-458-3p
  14. Python bivittatus (Burmese python) pbv-miR-458-3p
  15. Salmo salar ssa-miR-458-3p
  16. Sphenodon punctatus Spt-Mir-458_3p (mature (guide))
  17. Tor tambroides (Thai mahseer) miR-458-3p
  18. Xenopus laevis (African clawed frog) xla-miR-458
 Publications