Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-184 URS00005DFDA7_7955

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dre-miR-184: Dre-mir-184 is a microRNA that plays a role in the development and function of the retinal pigment epithelium (RPE) in zebrafish [PMC7844312]. Downregulation of dre-mir-184 leads to a decrease in the expression levels of RPE markers, while its overexpression stimulates RPE development by inhibiting the AKT2/mTOR pathway [PMC7844312]. In zebrafish embryos, the exogenous or endogenous expression of dre-mir-184 was modulated by injecting them with dre-mir-184 mimic or inhibitor [PMC5239556]. The injection of dre-mir-184 mimic resulted in robust expression of retinoid isomerohydrolase, a marker of RPE cells, while injection with dre-mir-184 inhibitor led to decreased reactivity of retinoid isomerohydrolase [PMC5239556]. The findings suggest that dre-mir-184 is important for maintaining the regular function and development of zebrafish RPE [PMC5239556]. Knocking down dre-mir-184 suppresses the expression of RPE markers, while overexpression promotes RPE development [PMC5239556]. The role of dre-mir-184 in RPE development was investigated using a zebrafish model [PMC5239556]. Dre-miR-724 and -725, along with other miRNAs such as -193a, -202, -205, and -133a, regulate various cellular processes including apoptosis and autophagy through their target genes [PMC5664119]. Dre-miR-2189 targets genes predominantly upregulated in modules such as cell cycle and apoptosis/autophagy modules [PMC5664119].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGACGGAGAACUGAUAAGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 68 other species

  1. Acyrthosiphon pisum api-miR-184a
  2. Aedes aegypti aae-miR-184
  3. Apis mellifera ame-miR-184-3p
  4. Bactrocera dorsalis (oriental fruit fly) bdo-miR-184
  5. Blattella germanica Bge-Mir-184_3p (mature (guide))
  6. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-184-3p
  7. Callorhinchus milii (elephant shark) Cmi-Mir-184_3p (mature (guide))
  8. Capitella teleta cte-miR-184a
  9. Centruroides sculpturatus (bark scorpion) Csc-Mir-184-P25_3p (mature (guide))
  10. Ciona intestinalis (vase tunicate) cin-miR-184
  11. Cochliomyia hominivorax mature cho-miR-184-3p
  12. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-184-3p
  13. Crassostrea gigas (Pacific oyster) Cgi-Mir-184-P7_3p (mature (guide))
  14. Culex quinquefasciatus cqu-miR-184
  15. Cyprinus carpio ccr-miR-184
  16. Daphnia magna Dma-Mir-184_3p (mature (guide))
  17. Daphnia pulex (common water flea) Dpu-Mir-184_3p (mature (guide))
  18. Drosophila ananassae dan-miR-184-3p
  19. Drosophila erecta der-miR-184-3p
  20. Drosophila grimshawi dgr-miR-184-3p
  21. Drosophila melanogaster (fruit fly) dme-miR-184-3p
  22. Drosophila mojavensis dmo-miR-184-3p
  23. Drosophila persimilis dpe-miR-184-3p
  24. Drosophila pseudoobscura dps-miR-184
  25. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294415_df_nrg
  26. Drosophila sechellia dse-miR-184-3p
  27. Drosophila simulans dsi-miR-184-3p
  28. Drosophila virilis dvi-miR-184-3p
  29. Drosophila willistoni dwi-miR-184-3p
  30. Drosophila yakuba dya-miR-184-3p
  31. Eisenia fetida (common brandling worm) Efe-Mir-184-o2_3p (mature (guide))
  32. Euprymna scolopes Esc-Mir-184_3p (mature (guide))
  33. Gadus morhua Gmo-Mir-184-P2_3p (mature (guide))
  34. Haplochromis burtoni abu-miR-184a
  35. Heliconius melpomene hme-miR-184
  36. Ictalurus punctatus (channel catfish) ipu-miR-184
  37. Ixodes scapularis isc-miR-184
  38. Lepisosteus oculatus (spotted gar) Loc-Mir-184_3p (mature (guide))
  39. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-184-P20_3p (mature (guide))
  40. Lingula anatina Lan-Mir-184_3p (mature (guide))
  41. Lottia gigantea (owl limpet) lgi-miR-184
  42. Lytechinus variegatus lva-miR-184-3p
  43. Manduca sexta (tobacco hornworm) mse-miR-184
  44. Maylandia zebra mze-miR-184a
  45. Melibe leonina mle-miR-184-3p
  46. Monopterus albus Mal-Mir-184-P2_3p (mature (guide))
  47. Mus musculus Mus_musculus piRNA piR-mmu-49530790
  48. Nasonia giraulti ngi-miR-184
  49. Nasonia longicornis nlo-miR-184
  50. Nasonia vitripennis (jewel wasp) nvi-miR-184
  51. Nautilus pompilius Npo-Mir-184_3p (mature (guide))
  52. Neolamprologus brichardi (lyretail cichlid) nbr-miR-184a
  53. Octopus bimaculoides Obi-Mir-184-P26_3p (mature (guide))
  54. Octopus vulgaris (common octopus) Ovu-Mir-184-P26_3p (mature (guide))
  55. Oreochromis niloticus oni-miR-184a
  56. Parasteatoda tepidariorum pte-miR-184-3p
  57. Patiria miniata (sea bat) pmi-miR-184-3p
  58. Penaeus japonicus miR-184
  59. Polistes canadensis pca-miR-184-3p
  60. Pundamilia nyererei pny-miR-184a
  61. Saccoglossus kowalevskii sko-miR-184-3p
  62. Scyliorhinus torazame (cloudy catshark) Sto-Mir-184_3p (mature (guide))
  63. Strongylocentrotus purpuratus (purple sea urchin) spu-miR-184
  64. Tetranychus urticae (two-spotted spider mite) tur-miR-184-3p
  65. Tetraodon nigroviridis Tni-Mir-184-P2_3p (mature (guide))
  66. Tor tambroides (Thai mahseer) miR-184
  67. Tribolium castaneum tca-miR-184-3p
  68. Triops cancriformis tcf-miR-184-3p
Publications