Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-9 precursor (hsa-mir-9-3) URS00005D97FE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR9-3: MIR9-3 is one of the 12 common genes that showed methylation in both primary tumors associated with metastasis and advanced stages [PMC8835734]. The methylation status of the three MIR9 promoters, including MIR9-3, was analyzed using Methylation Specific PCR (MSP) [PMC5366901]. The primer sets used in the analysis were designed based on the CpG region encompassing the transcription start sites of MIR9 genes, which were validated by RACE [PMC5366901]. MIR9-1, MIR9-2, and MIR9-3 are located on chromosomes 1, 5, and 15 respectively [PMC9220270].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAGGCCCGUUUCUCUCUUUGGUUAUCUAGCUGUAUGAGUGCCACAGAGCCGUCAUAAAGCUAGAUAACCGAAAGUAGAAAUGAUUCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pteropus vampyrus miRNA (ENSPVAG00000027215.1)
Publications