v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) REPIN1 antisense RNA 1 URS00005D6CEA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

REPIN1-AS1: REPIN1-AS1 is a long non-coding RNA (lncRNA) that has been identified as a potential protective factor in certain diseases, including stomach adenocarcinoma (STAD) [PMC9453157]. In a study, AL136115.1, AL355574.1, and REPIN1-AS1 were reported as favorable underlying factors for STAD patients [PMC9453157]. Conversely, AL391152.1, AC005165.1, AC104695.3, and AC129507.1 were identified as risk lncRNAs for STAD patients [PMC9453157]. A risk score formula was developed to assess the risk of STAD based on the expression levels of various lncRNAs including REPIN1-AS1 [PMC9453157]. REPIN1-AS1 was also included in an overall survival (OS) signature along with other lncRNAs to predict the prognosis of patients [PMC8855154]. In conclusion, REPIN1-AS1 is an important lncRNA that has been implicated in various diseases and can serve as a potential protective factor or risk indicator depending on the context [PMC9453157][PMC8855154].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CGAUGCGCCGCCAGAUGGCUGCCCUGGGAGAAGCGGCGGCCGCACUCCUCGCAGGCGAAGGGCCGCUCGCCGGAGUGCACGCGCGAGUGCGCCACCAGCCCCGGACAGGAGCUGCCAUCUAUGAACCCCUAGAGCCCCGGACAUGGAGCUAGACUACUCUCCUGUUUCCUUGUGUGCCUCCAUUAGAGGAAAUGUCUCUUCUCCCAGUCAGGAGUUAACCACCUGCUGUAACUUCCUCUUUAGCAUCGCCAGAGGAAACUAAGUAUGACUGUGCCUUCACUCUGCAGAAAGAAAAUGAGUGGCAAAGGAGUUGCGAAGGGAUUCCUGAGCCUUUAUGCCAGCUGGAAGCUUAAGGCCUUGGUAUUUGAGACUUCACCCUUCAAAAUGUCUUGGAGGAUGGCCCAGCAACCAGCCAAAUGGCCCAAUGGCCUAGCCCAGUGGAGACGGUCUCAGCUUUUGACAAGCUAGCCGGAGAAAGGGCUGGACAGGAAGGGGCCCACUGGACAGCGAAUAUUGAUAGGGCCCCUGGGAGGAUCAAUUUUCCCCUCCAACAGUGCCUGGCUCCCAUUAUCAGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications