Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4515 URS00005D35D9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4515: Hsa-mir-4515 is a microRNA that has been found to be down-regulated in various studies. In a study on renal epithelial progenitor (REP) patients, hsa-mir-4515 was one of the five differentially expressed miRNAs that were down-regulated [PMC8326912]. Similarly, in the plasma samples of acute Kawasaki disease (KD) patients, hsa-mir-4515 was significantly downregulated compared to healthy controls [PMC6667785]. Another study on acute KD patients also found hsa-mir-4515 to be significantly downregulated in plasma samples [PMC6611386]. In addition, hsa-mir-4515 was identified as one of the differentially expressed miRNAs between acute KD and normal controls [PMC8044791]. The role of hsa-mir-4515 in KD has not been extensively studied and reported in the literature so far [PMC8044791]. Overall, these studies suggest that hsa-mir-4515 is consistently downregulated in REP patients and acute KD patients compared to healthy controls. However, further research is needed to fully understand the role and significance of hsa-mir-4515 in these conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGACUGGACUCCCGGCAGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications