Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-518f-5p URS00005CF1BF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-518f: Hsa-mir-518f, along with hsa-miR-543, has been found to match the regulated gene in expression trends [PMC5937522]. Further research on hsa-mir-518f is considered important [PMC5937522]. Hsa-miR-543 has been associated with the gene ZNRD1, while hsa-mir-518f has been linked to the gene CAT [PMC5937522]. Hsa-miR-518e and hsa-miR-518b, which are homologues of hsa-mir-518f, have been shown to be upregulated in hepatocellular carcinoma (HCC) [PMC5937522]. The specific role of hsa-mir-518f in chemoresistance or tumor development is not well understood [PMC5937522]. Comparing the targets with hub genes revealed that ZNRD1 is a potential target of hsa-miR-543, while CAT is a potential target of hsa-mir-518f [PMC5937522]. Additionally, it has been demonstrated that hsa-mir-518f is associated with cardiomyopathy [PMC8256614].

Genome locations

Gene Ontology annotations

Localisation

No annotated location

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCUAGAGGGAAGCACUUUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Gorilla gorilla gorilla ggo-miR-518f-5p (MIR518F)
  2. Gorilla gorilla (western gorilla) ggo-miR-518f-5p
Publications