Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small Cajal body-specific RNA 4 (SCARNA4) secondary structure diagram

Homo sapiens (human) small Cajal body-specific RNA 4 (SCARNA4) URS00005C0742_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SCARNA4: SCARNA4 is a type of H/ACA scaRNA that has been found to be down-regulated in Tetralogy of Fallot (TOF) [PMC6466398]. It is a fragment of the snoRNA SCARNA4 [PMC6042801]. SCARNA4 has been downregulated by PCB 138 and PCB 28 in common with other genes such as SEPP1 and SIGLEC1 [PMC6617415]. It has also been found to be downregulated by PCB 153 and 138 along with genes like CCL7, CCL8, GMPR, APOBEC3A, IFIT1, and RSAD2 [PMC6617415]. SCARNA4 is one of the snoRNAs that are associated with miRNAs such as SNORA36, SNORA81, SNORD59, SNORA53, SCARNA15, and SNORA18 [PMC4124155]. In various cancer types including bladder carcinoma (BLCA), breast adenocarcinoma (BRCA), colon adenocarcinoma (COAD), head and neck squamous cell carcinoma (HNSC), kidney clear cell carcinoma (KIRC), lower grade glioma (LGG), lung squamous cell carcinoma (LUSC), pancreatic adenocarcinoma (PAAD), and stomach adenocarcinoma (STAD), sdRNAs derived from SCARNA4 have been identified as potential small RNA markers for cancer immunity and clinical outcome [PMC6294694]. In Xenopus tropicalis experiments, artificial U2-Ψ60 guide RNAs derived from SCARNA4 have been used for pseudouridylation of U2 snRNA at position 60 [PMC8522698]. RT real-time PCR validation experiments have shown that the expression level of SCARNA4 can be evaluated using the TaqMan assay system [PMC5589598]. SCARNA4 has been chosen for further analysis in relation to other snoRNAs [PMC6539089]. SCARNA4 is transcribed by RNA polymerase II and is involved in an altered regulatory network along with other RNA species transcribed by RNA polymerase III [PMC3938749]. Human SCARNA4 has been found to modify position 42 in yeast U2 snRNA [PMC5733568]. SCARNA4 has also been identified as one of the reference genes for data normalization [PMC8271217]. In X. tropicalis experiments, an artificial guide RNA for human 18S-892 has been generated by antisense element replacement in SCARNA4 [PMC6298559]. In the context of sweat, scRNA11 and SCARNA4 are well-represented members of the RNA modifying small RNA family located in Cajal bodies [PMC8188706].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGGAGGACUAAGAAGGCUGAGUCUGAUGAAGUAAGACUUUGCUGAUACAUUCCUCCUAGAAAAAAGGGUUGGAGAGAGCAGCCUUCACUGAAGAGUAUCACAGGGCUGACUGUACUACCCAACACUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications