Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-183 precursor URS00005BBC98_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR183: MIR183, a type of microRNA, was investigated in a study comparing its levels in the serum of mice with ototoxicity to levels in the cochlea and kidney using qRT-PCR [PMC6163699]. The study aimed to understand the role of MIR183 in ototoxicity and its potential as a biomarker [PMC6163699]. Additionally, MIR183 was found to be closely associated with lymph node metastasis in 54 sporadic MTCs [PMC8074316]. This suggests that MIR183 may play a role in the progression and metastasis of medullary thyroid carcinoma [PMC8074316]. The findings highlight the potential clinical significance of MIR183 as a biomarker for lymph node metastasis and its potential as a therapeutic target for medullary thyroid carcinoma [PMC8074316]. Further research is needed to elucidate the underlying mechanisms by which MIR183 contributes to these processes [PMC8074316]. The qRT-PCR analysis used in these studies provides quantitative data on microRNA expression levels, allowing for accurate comparisons between different tissues and conditions [PMC6163699]. Overall, these studies shed light on the involvement of MIR183 in ototoxicity and lymph node metastasis, providing valuable insights for future research and clinical applications [PMC6163699] [PMC8074316].

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCGCAGAGUGUGACUCCUGUUCUGUGUAUGGCACUGGUAGAAUUCACUGUGAACAGUCUCAGUCAGUGAAUUACCGAAGGGCCAUAAACAGAGCAGAGACAGAUCCACGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Publications