Homo sapiens (human) small nucleolar RNA, C/D box 63 (SNORD63)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 63 (SNORD63) URS00005BBB0D_9606

68 nucleotides
9 databases (ENA, Ensembl, GeneCards, HGNC, MalaCards, RefSeq, Rfam, snoDB, snOPY)
Found in 5 other species
88 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD63: SNORD63, a small nucleolar RNA, along with SNORD96A, is believed to play a crucial role in the tumorigenesis and development of clear cell renal cell carcinoma (ccRCC) [PMC7812721]. However, the underlying molecular mechanisms of their involvement in ccRCC require further investigation [PMC7812721]. In a study, SNORD20, SNORD69, and SNORD63 were identified in at least 19 out of 20 samples analyzed [PMC8188706].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GUGCAAUGAUGUAUUUUAUUCAACACAUCAUUCUGAAAGAACGUGUGGAAAACUAAUGACUGAGCACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.