v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) PLCH1 antisense RNA 1 (PLCH1-AS1) URS00005B3A67_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PLCH1-AS1: In a study, PLCH1-AS1 was predicted to have binding sites with EIF4A3 along with 15 other lncRNAs in ovarian cancers (OCs) [PMC7272521]. These lncRNAs, including PLCH1-AS1, were found to be enriched in various cancer-related pathways [PMC7272521]. The study also demonstrated that the expression profiles of these lncRNAs, including PLCH1-AS1, were altered when OCs were treated with ivermectin [PMC7272521]. Another analysis of OC databases confirmed that PLCH1-AS1 was associated with OC overall survival and had binding sites with EIF4A3 [PMC7272521]. Furthermore, PLCH1-AS1 was identified as one of the lncRNAs in a 7-lncRNA prognostic signature for OC [PMC6794712]. However, no previous studies have reported any association of PLCH1-AS1 with cancer [PMC6794712].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAGCAUUUCUCCACCAAAGCAUGGCUCCAUGACUCGGUAGAUGAAAUGAAAUGUUGCCAGAAGCGUCGUGUGCUAUCUCGUGUUUGACUCUCUACCUGCUCUUCCCCUGCAGUAGUAAUCGUGGGAGCAUGUAUAUUUACGGAGGUGUCAUAAGAUCAAACAGCCUGGAAGGAAGAGCCAAUGCCUGAAAAACAGCUGCUGUGACGAGCUGCCUGAACCCUCAGCCAACUUUGUUACUUUGUGAAAUGGAACUACCAUCCGCCAAGAUAUUCAAGAGAGAAAAAAAUACAUUUUCUGCAUAAAUGGUGAAAUCUUUUGUUUCCUUCCCACUCCUUAGUAGACCCUUUCAACCCCUUUCCCACCUUUUUCACCUGGAAAAUUUCUACUCAUCCUUCACAAAUCAAUUUGAGCAUCAUCGCUGCCUCCAGGCAAGGUGGCCACAUAAUUUGGGUGGCCCAGUGCAAAAUAAAAAACGAAAAUCUCACAGGUGGAAUUCAACAUAUCCCUUCCACAGGAGGUCAUCCCAAUCCAAAAUAUUUAGACUUUGCACAGGGAAACACUUGGCAUCUGAUUUGGGAACAGGCGAGAAGUCCCUGCUGAUCCAAACACGGCUGUUGCUCUGCCAGCCAAGGCAGAAACAACUGCUGCCUUGCGUUGCCCCGGACACUGUGGCGCACAAACCUGAGCUUGACCCUCCAUGCUUCUACACUGUGGCCCCUGCUGGGGAAAAAGAGUGAUGGCCAAACCUGACCUUGAACCUCCAUGCUUCUAUGCUGUGGCCUCUGCUGGGAAAAAGGAGGAUGAUGGCCUCCUCCUGCCCUAGAGUUCUAGCAGGCUGUAAAUGGGCCAGGGAGGAGGGAGGCAGCCAAAAGUGAAUAGCACAAGAUGAGCAGAGGCUUCAAGUGCCCAUCAUGUGCUCCAUUGUCCCAUUGGACUUCAUUUACAAAACACAAAUUCAAAGAUGAAACUAAAAAUUUCAAAAGGGGGCCACAGAGCAUUAAGCCCCAAGCACUAACAAUUCUGAGGGUAAGGCCCUAAGCUACCUGAUUGCAUGCCUCUGUAGUUGGUCCUGCCUCCAGAAAAUUUUCCCUGACCAGGCCCCUCAAACCAAGCUAGCUGCCCCUUUCUGUUCUUCCUAUUUAACCCAUGCUUGCCUUUGUCGCUGCACUUAGUACAUUAUAUUAAUAUUAUCUAUUUAUGUGUAUGUUUCACAAAAUAUUUUAUAACUUCAUAAGGUCAAGGAAUUCGGUUAAAUCUUUUUUCUCCAAUUUCUAAAUCUUAAUACUAUAUUAAAAUUGCUUCUUCAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications