Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-7706 URS00005B08C1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-7706: Hsa-mir-7706 is a microRNA that has been found to be significantly upregulated in various studies [PMC9065123]. In one study, it was observed that hsa-mir-7706 exhibited a greater than 6 log2 fold change of expression in response to EGCG treatment [PMC6359307]. Another study identified hsa-mir-7706 as one of the nodes with high connectivity degree [PMC7235675]. Furthermore, hsa-mir-7706 was found to be downregulated in certain conditions, such as HCV-HCC and HP-EC-EVs group [PMC7738825] [PMC9123672]. In the context of hepatocellular carcinoma (HCC), downregulation of hsa-mir-7706 was shown to inhibit the proliferation of HCC cells and may serve as a potential therapeutic target for HCC treatment [PMC7738825]. Additionally, hsa-mir-7706 expression was found to be associated with the activation of C06_CD4-CCR7 in HCC [PMC7738825]. Furthermore, various genes have been predicted to be regulated by hsa-mir-7706, such as CCND1 and BTG2 [PMC8264660]. Lastly, the upregulation of hsa-miR-3610 and hsa-mir-7706 expression was negatively correlated with overall survival in certain studies [PMC7499949].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAGCGCCUGUGCUCUGCCGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications