Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-552_5p (mature (co-guide)) URS00005AD632_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-552: hsa-mir-552 is a microRNA (miRNA) that has been identified as a key player in the miRNA-gene network [PMC5652954]. It, along with hsa-miR-30a, plays an important role in regulating target genes [PMC5652954]. In a study using TCGA data, 114 differentially expressed miRNAs were identified, including hsa-mir-552 [PMC5950030]. While hsa-miR-10a has been proposed as a potential circulating biomarker for pancreatic cancer patients, there is currently no available publication on the role of hsa-mir-552 and hsa-miR-323-3p [PMC5877771]. The down-regulation of hsa-mir-552 is likely to influence the expression of 10 pRS-related mRNAs [PMC8176413]. In another case study, module #161 includes seven miRNAs, including hsa-mir-561 and hsa-mir-552, which are associated with colonic neoplasms [PMC9618768]. References: [PMC5652954]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5652954/ [PMC5950030]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5950030/ [PMC5877771]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5877771/ [PMC8176413]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8176413/ [PM7532495]: This reference does not exist. [PM9618768]: https://www.ncbi.nlm.nih.gov/pmc/articles/PM9618768/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUUUAACCUUUUGCCUGUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications