Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 33 (SNORA33) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 33 (SNORA33) URS00005A3020_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA33: SNORA33 is a C/D box small nucleolar RNA (snoRNA) [PMC3120706]. In HEK293T FUS KO cells, increased pseudouridylation at specific sites was accompanied by elevated levels of SNORA33 [PMC9941101]. SNORA33 is the genuine guide RNA for the pseudouridylation of a specific site in the 28S rRNA [PMC6984369]. SNORA33 has been associated with normal human aging [PMC7355415]. It is part of the H/ACA snoRNA gene cluster_739 [PMC7049693]. SNORA33, along with other snoRNAs, binds to EZH2, suggesting a role in rRNA processing [PMC7959742]. The interaction between EZH2 and SNORA33 was validated using a tagged RNA pull-down assay [PMC7959742]. SNORA33 displays similar changing patterns during early hypertrophy and is downregulated in certain conditions [PMC7959742] [PMC7461500] [PMC6036822] . Small RNA fragments derived from SNORA33 have been shown to produce measurable gene silencing effects, unlike other small RNAs derived from different sources [PMC7038934]. It is consistently male-biased in five tissues and has been identified as one of the exclusively male-biased genes along with STC2, ANGPTL4, TPSAB1, TPSB2, and SNORD genes[ PMC8455523]. The expression of SNORA33 is regulated by MRES-CoV infection and certain compounds[ PMC8618917].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCCAGCCAAUGAAUCUGCUUACCUGAUUGUGUUUGUGCAGACAUACUUUAAAAACUGGCAAUAGUAAAGCCAUGUUACGAGCCUUAAGGACAUUGAAGUCGUUAAGGUCCCUGAGAAUGGCUAUAACAAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications