Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-186 precursor URS000059EAAC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR186: MIR186 is a microRNA that has been identified as down-regulated in human prostate cancer (PCa) specimens, particularly in metastatic patients [PMC8431208]. Recent research has suggested that MIR186 acts as a metastasis suppressor in PCa [PMC8431208]. Furthermore, MIR186 has been found to play a tumor suppressive role in PCa by inhibiting tumorigenesis and metastasis, with its expression level being inversely correlated with clinical grade and pathological grading [PMC5078081]. Additionally, low expression of MIR186 has been associated with poor patient survival [PMC5078081]. Correlation analyses have revealed a positive correlation between miR25 and IL-12, while no significant correlations were found between miR21 and IL-21 or MIR186 and IL-12 [PMC9013931]. The role of the long non-coding RNA (lncRNA) PVT1 in regulating the expression of MIR186 has been demonstrated using lncRNA PVT1 silenced cholangiocarcinoma (CCA) cell lines [PMC8286192]. Overall, these findings highlight the importance of MIR186 as a potential therapeutic target for PCa due to its involvement in metastasis suppression and tumor suppression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCUUGUAACUUUCCAAAGAAUUCUCCUUUUGGGCUUUCUGGUUUUAUUUUAAGCCCAAAGGUGAAUUUUUUGGGAAGUUUGAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

Publications