Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-520h URS000059C31C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-520h: Hsa-mir-520h is one of the differentially expressed hsa-miRs that were analyzed in the study [PMC6719224]. The study used a heatmap and hierarchical clustering to visualize the expression patterns of these hsa-miRs [PMC6719224]. The heatmap and clustering analysis included several other hsa-miRs, such as hsa-let-7b-5p, hsa-miR-143-3p, hsa-miR-148b-3p, hsa-miR-26a-5p, hsa-miR-502-5p, hsa-mir-520h, hsa-miR-548d3p, hsa-miR5905p and hasmiR644a [PMC6719224]. Additionally, the expression of hasmiR520h was found to be significantly associated with E1A-mediated tumor suppression and cell migration during cancer metastasis [PMC4159108]. Inhibition of hasmiR520h was shown to decrease the ability of cancer cells to migrate and invade other areas of the body [PMC4159108]. These findings suggest that hasmiR520h plays a role in cancer metastasis and may be a potential target for therapeutic interventions aimed at inhibiting cancer cell migration [PMC4159108].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAAAGUGCUUCCCUUUAGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications