Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 2B (SNORA2B) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 2B (SNORA2B) URS0000599BEA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA2B: SNORA2B is a small nucleolar RNA (snoRNA) that belongs to a group of snoRNAs with similar sequences, which are given similar names with differing suffixes [PMC8178906]. In antipsychotic-specific analyses, SNORA2B was found to be associated with QTc change to aripiprazole [PMC8825824]. In patients with chronic lymphocytic leukemia (CLL) and an extra chromosome 12, SNORA2B was upregulated compared to non-12+ CLL patients [PMC9219770]. SNORA2B, along with two other snoRNAs (SNORA32 and SNORA55), displayed significant levels of false discovery rate (FDR) in a study [PMC6154026]. Additionally, SNORA2B was among the twenty genes selected in another study related to various diseases [PMC8606581]. In ovarian cancer, SNORA2B was identified as one of the snoRNAs associated with poor prognosis and screened out by Kaplan-Meier analysis [PMC6686521]. Furthermore, low expression of SNORA2B has been linked to poor prognosis in ovarian cancer patients [PMC6686521]. In summary, SNORA2B is a snoRNA that has been implicated in various biological processes and diseases. It has been associated with antipsychotic-induced QTc changes, upregulated in CLL patients with an extra chromosome 12, displayed significant FDR levels along with other snoRNAs, and identified as one of the snoRNAs associated with poor prognosis in ovarian cancer. These findings highlight the potential functional roles of SNORA2B in different contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGCCCUGAAUCAAGGCCAGCAGUUUGCUGAAGCUGUUGGUUUCAAGCAGGAGCCUAAAGAAUUGUCUUUCUAUGGUCUGUUGGCCAUUUCAUAACUUUGGAAAUGUAAUGGUCAAUUCAUUAGAAAGAAACAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications