Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Arg (CGN) (MT-TR) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Arg (CGN) (MT-TR) URS00005983A6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TR: MT-TR is a gene that plays a role in various biological processes and is associated with different conditions. It contains a homopolymeric tract of 8 consecutive adenosine residues [PMC3258376]. The anticodon of MT-TR can vary among different species, with some having TCG and others having ACG [PMC8727539]. Certain regions of MT-TR, such as the origin of light strand replication and the polymorphic region, were ignored in a study [PMC2214808]. PCR was used to amplify the MT-TR gene from total genomic DNA using specific primers [PMC3258376]. A hotspot for mutations was identified in the MT-TR gene, and one particular point mutation was found to be common in certain tumor samples but not in normal tissues [PMC3258376]. The polymorphic nature of MT-TR is well-known among common inbred strains [PMC5897405]. A single nucleotide insertion in the MT-TR gene was found to be responsible for a phenotypic effect [PMC4366423]. Additionally, MT-TR is one of several genes analyzed for genetic causes of channelopathies and cardiomyopathies [PMC7290503]. In one patient, a deletion spanning several genes including MT-TR was observed through direct sequencing of mtDNA [PMC3592399]. References: [PMC4366423] [PMC3258376] [PMC8727539] [PMC2214808] [PMC5897405] [PM7290503] [PM3592399]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUAUAUAGUUUAAACAAAACGAAUGAUUUCGACUCAUUAAAUUAUGAUAAUCAUAUUUACCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Cloning vector pRS316-1B9 tRNA-Arg
  2. Homo heidelbergensis (Heidelberg man) tRNA-Arg
  3. Homo sapiens neanderthalensis neanderthalensis tRNA-Arg
  4. Homo sapiens subsp. 'Denisova' subsp. 'Denisova' (Denisova hominin) transfer RNA-Arg
2D structure Publications