Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-484 URS0000597BED_9606

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGGCUCAGUCCCCUCCCGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Bos taurus bta-miR-484
  2. Cricetulus griseus cgr-miR-484
  3. Macaca mulatta mml-miR-484
  4. Mus musculus mmu-miR-484
  5. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-484
  6. Pan paniscus ppa-miR-484
  7. Pan troglodytes ptr-miR-484
  8. Pongo pygmaeus ppy-miR-484
  9. Rattus norvegicus rno-miR-484
Publications